s689003 s689003

11-03-2021
Biology

contestada

What is the complementary strand of DNA to the one below?
AAACCGTATCCGCGGTATATCGCCGGAAT

Respuesta :

nsjwjwiaoaosksjja nsjwjwiaoaosksjja

11-03-2021

lick me , tease me , touch me , please me

AHAHA SORRY

Answer Link

05-04-2021

Answer:

TTTGGCATAGGCGCCATATAGCGGCCTTA

Answer Link

Otras preguntas

How do you solve the following equation: a/9.05=8.2

Which of the following is equivalent to sin theta csc(–theta) wherever sin theta csc(–theta) is defined? F. –1 G. 1 H. –tan theta J. tan theta K. –sin2 thet

The expression −8x^3(7x^6 − 3x^5) is equivalent to: A. −56x^9 + 24x^8 B. −56x^9 − 24x^8 C. −56x^18 + 24x^15 D. −56x^18 − 24x^15 E. −32x^4

The weekly fee for staying at the Pleasant Lake Campground is $20 per vehicle and $10 per person. Last year, weekly fees were paid for v vehicles and p persons

1.Which of the following types of words must be capitalized? A. The first and last word of every sentenceB. First, last, and main words in a book titleC. All pr

What is the degree measure of the acute angle formed by the hands of a 12-hour clock that reads exactly 1 o’clock? A. 15° B. 30° C. 45° D. 60° E. 72°

What is the greatest common factor of 42, 126, and 210 ? F. 2 G. 6 H. 14 J. 21 K. 42

I don't understand how to get 50000 ohms, please can someone help? I would have just left my answer at 25,000 ohms!

In the standard (x,y) coordinate plane, what are the coordinates of the midpoint of a line segment whose endpoints are (–3,0) and (7,4) ? A. (2,2) B. (2,4) C. (

Write a paragraph about computer