grace5696 grace5696

12-05-2020
Biology

contestada

why do we track the population of producers when we look at ecological succession

Respuesta :

chtlo123456789 chtlo123456789

12-05-2020

Answer:

producers attract consumers, so the more producers that are present, the later the stage of succession is.

Explanation:

Answer Link

Otras preguntas

compression is defined as a region of

alguien puede ayudarme con esto por favor necesito el procedimiento

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5 ′ − GGCCCUUUUAGGGCCAAAAA − 3 ′ a sequence of uracil–ade

Most geologists believe that the dinosaurs became extinct 65 million years ago when a large comet or asteroid struck the earth, throwing up so much dust that th

Art and his friends spent $62 at the movies. Admission tickets cost $12 apiece, and a bucket of popcorn costs $7. Which equation written in standard form repres

Solve the system of equations using substitution.

o. Math and Science A science classmeasured the mass of a balloon to be4 grams. After the balloon was inflated.the mass was 8 grams. What was themass of the air

Create an expression that equals 4. You can only use the numbers 1,2,3,4,5. Use all five numbers in each expression. Each number cannot be used more than once i

A new viral pathogen has emerged, and you have been asked to develop an ELISA-based detection assay to the intact virions. In order to ensure that a mutation in

when and where was the first battle of the Civil War? And who won?