saniabell saniabell

11-04-2020
Mathematics

contestada

Simplify the expressions below
1) 2x + 5 – 3y – 7x + y -8
Please simplify

Respuesta :

Аноним Аноним

11-04-2020

Answer:

−5x − 2y − 3

Explanation:

2x + 5 − 3y − 7x + y − 8

= 2x + 5 + −3y + −7x + y + −8

[ Combine Like Terms ]

= 2x + 5 + −3y + −7x + y + −8

= (2x + −7x) + (−3y + y) + (5 + −8)

= −5x + −2y + −3

Answer Link

Otras preguntas

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha

employees in the sales department need to be able to access the sales share on the file server. they will need to have the ability to create files, read them, a

which of the following is a product cost? a.salary of a sales manager b.salary of the company receptionist c.drill bits for a drill press used in the plant asse

The weights for 12-month-old baby boys are normally distributed with a mean of 22.5 pounds and a standard deviation of 2.2 pounds. Find the percentage to the ne

we will model the spine and upper body as a horizontal rigid rod of uniform density with a length of 50.0 cm and a mass of 40.0 kg. assume that the person attem

Read the following thesis statement and determine whether or not it is effective and the reason for its effectiveness or lack thereof. In steinbecks novel, the

Can someone help me find my other account please and quick

Need help ASAP!! Write an CER about the Lincoln-Douglas Debates. This should be six to seven sentences long. Include transitional phases to introduce the eviden

Mason Auto Repair specializes in the repair of foreign car transmissions. To encourage business, Mason offers a 6-month warranty on all repairs. The following d

the client's parents have begun a program of therapy that includes giving the client a token each time the client follows directions. which theoretical framewor