blossie8419 blossie8419

10-05-2018
Biology

contestada

Which modern human population exhibits the greatest genetic diversity today?

Respuesta :

ferahgo78 ferahgo78

10-05-2018

Sub-saharan Africans

Answer Link

Otras preguntas

Which of the following are true of the Concordat of 1801? Select all that apply. It made the Catholid Church as powerful under the new regime as it was before t

hellsuahuauahuabuauhuauuhaajbaabaaaa

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha

in amps. a constant voltage of 77 volts is put across a resistance that is increasing at a rate of 0.20.2 ohms per second when the resistance is 55 ohms. at wha

which of the four basic sales organization structures is trending? that is, which structure has been recently adopted by some of the u.s.' biggest companies is?

Find the distance between -3 + 5i and 2 - 9i

What is the name of the technology that appeared in the period between 13,000 and 11,000 years before the present, and spread rapidly?

which of the following is not typical of individuals with antisocial personality disorder? which of the following is not typical of individuals with antisocial

a line with a y-intercept of 4 passes through the point (14, -3). it also passes through point (x, -8). what is the x coordinate for that point?: * a) 8 b) 24 c

and the area of the quadrilateral. 18cm 12cm 100m